Search

Michael L Shelanski

from Brooklyn, NY
Age ~83
Get Report
Also known as:
Mike L Shelanski, Michale L Shelanski, Michael L Shelansky, Mlchael Shelanski, Mich Shelanski, Michael I
Phone and address:
241 Kane St APT 1, Brooklyn, NY 11231
(718) 624-7445
Related to:
Kathleen A Lakritz, 65Nina M Shelanski, 24Howard ShelanskiNoah E Shelanski, 50Isaac ShelanskiSamuel A Shelanski, 57Howard A Shelanski, 60Howard G Wallen, 55Vivien B Shelanski, 82Karen Schwartz, 62
Connected to:
Narvic A Shelanskey, 39Juliann Shelar, 67Mahendra K Shelar, 48Manoj N Shelar, 45Mary T Shelar, 94Namrata Shelar, 38Sonali S Shelar, 50Vinay S Shelar, 60Joseph L Shelata, 51Purvesh Shelat, 33

Michael Shelanski Phones & Addresses

  • 241 Kane St APT 1, Brooklyn, NY 11231 (718) 624-7445
  • Hawthorne, CA
  • Mamaroneck, NY
  • New York, NY
  • Los Angeles, CA
  • Bronx, NY

Education

School / High School: University Of Chicago/The Pritzker School Of Medicine 1966

Languages

English

Specialities

Oncology

Professional Records

Medicine Doctors

Michael Shelanski Photo 1

Dr. Michael L Shelanski, New York NY - MD (Doctor of Medicine)

View page
Specialties:
Oncology
Address:
1130 Saint Nicholas Ave, New York, NY 10032
Languages:
English
Education:
Medical School
University Of Chicago/The Pritzker School Of Medicine
Graduated: 1966
Medical School
Bronx Municipal Hospital Center
Graduated: 1966
Michael Shelanski Photo 2

Michael L. Shelanski

View page
Specialties:
Anatomic Pathology, Anatomic Pathology & Clinical Pathology
Work:
Columbia University Medical Center Pathology
622 W 168 St Ph 1564W STE 1564H, New York, NY 10032
(212) 305-7399 (phone), (212) 342-3013 (fax)
Education:
Medical School
University of Chicago Pritzker School of Medicine
Graduated: 1966
Languages:
English
Description:
Dr. Shelanski graduated from the University of Chicago Pritzker School of Medicine in 1966. He works in New York, NY and specializes in Anatomic Pathology and Anatomic Pathology & Clinical Pathology.
Michael Shelanski Photo 3

Michael Lea Shelanski, New York NY

View page
Specialties:
Pathology
Anatomic Pathology & Clinical Pathology
Anatomic Pathology
Neuropathology
Work:
Columbia University
630 W 168Th St, New York, NY 10032
Education:
University of Chicago (1966)

Resumes

Resumes

Michael Shelanski Photo 4

Michael Shelanski

View page
Location:
United States
Michael Shelanski Photo 5

Michael Shelanski

View page

Business Records

Name / Title
Company / Classification
Phones & Addresses
Michael Shelanski
Pathologist
Columbia University Medical Center
Medical Doctor's Office
622 W 168 St, New York, NY 10032
Michael L. Shelanski
Director
Neurosurgical Associates Inc
Medical Doctor's Office · Neurosurgeon · Offices of Physicians, Except Mental Health
710 W 168 St, New York, NY 10032
(212) 305-5543, (212) 305-7346, (212) 305-4118

Publications

Us Patents

Antisense Compounds Which Prevent Cell Death And Uses Thereof

View page
US Patent:
7223856, May 29, 2007
Filed:
Jun 28, 2002
Appl. No.:
10/185084
Inventors:
Carol M. Troy - Hastings-on-Hudson NY, US
Michael L. Shelanski - Brooklyn NY, US
Assignee:
The Trustees of Columbia University in the City of New York - New York NY
International Classification:
C07H 21/04
C07H 21/02
A61K 38/00
C12P 19/34
C12N 15/88
US Classification:
536 245, 435 6, 435 911, 435366, 435368, 435455, 435458, 530326, 536 231
Abstract:
The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ effective to inhibit death of the cell.

Peptide Having Hydrolase Activity

View page
US Patent:
7947279, May 24, 2011
Filed:
Jun 29, 2006
Appl. No.:
11/477771
Inventors:
Ottavio Arancio - New York NY, US
Michael L. Shelanski - Brooklyn NY, US
Bing Gong - Fort Lee NJ, US
Assignee:
The Trustees of Columbia University in the City of New York - New York NY
International Classification:
A61K 39/00
A61K 39/385
C07K 1/00
US Classification:
4241851, 4241921, 4241941, 530350
Abstract:
The invention is directed to methods for increasing learning and memory in a subject with a neuropathological condition, specifically a condition related to elevated beta-amyloid deposition, the method comprising administering to the subject an effective amount of a compound capable of increasing the activity of Uch-L1. The invention is also directed to screening methods for identifying compounds that enhance the activity of the proteasome system, Uch-L1, or both.

Antisense Oligonucleotides And Related Methods For Regulating Cell Death

View page
US Patent:
20040254136, Dec 16, 2004
Filed:
Jul 26, 2004
Appl. No.:
10/482952
Inventors:
Carol Troy - Hastings-on-Hudson NY, US
Michael Shelanski - Brooklyn NY, US
International Classification:
A61K048/00
C12Q001/68
C07H021/04
US Classification:
514/044000, 435/006000, 536/023200
Abstract:
This invention provides a first nucleic acid which specifically hybridizes to a nucleic acid encoding an inhibitor-of-apoptosis protein. This invention also provides related compositions and methods for inducing cell death and treating cancer using same. This invention further provides a second nucleic acid which specifically hybridizes to a nucleic acid encoding a protein, other than caspase-2, that induces cell death. Finally, this invention provides related compositions and methods for inhibiting cell death, inhibiting neuronal cell death in particular, and treating a neurodegenerative disorder and a heart disorder using the second nucleic acid.

Atf4 As A Therapeutic Target In Alzheimers Disease And Other Neurological Disorders

View page
US Patent:
20090148450, Jun 11, 2009
Filed:
Sep 12, 2008
Appl. No.:
12/209713
Inventors:
Lloyd Greene - Larchmont NY, US
Michael Shelanski - Brooklyn NY, US
Conrad Leung - New York NY, US
Ottavio Valerio Vitolo - Cambridge MA, US
International Classification:
A61K 39/395
A61K 31/7052
G01N 33/68
G01N 33/50
C07H 21/00
C07K 16/00
C12Q 1/02
C12Q 1/68
A61P 25/00
US Classification:
4241351, 514 44, 436 86, 436 94, 536 231, 5303879, 435 29, 435 6
Abstract:
The present invention relates to methods and compositions for treating Alzheimer's Disease and other neurological disorders by inhibiting expression and/or activity of ATF4. It further provides for diagnostic methods and reagents as well as assays to identify agents for the treatment of Alzheimer's Disease and other ATF4-related conditions.

Ginkgolide Compounds, Compositions, And Extracts, And Uses Thereof

View page
US Patent:
20090156668, Jun 18, 2009
Filed:
Mar 21, 2005
Appl. No.:
10/593427
Inventors:
Ottavio V. Vitolo - Cambridge MA, US
Koji Nakanishi - New York NY, US
Michael L. Shelanski - Brooklyn NY, US
Sonja Krane - Del Mar CA, US
Ottavio Arancio - New York NY, US
Stanislav Jaracz - Trinec, CZ
Nina D. Berova - New York NY, US
Assignee:
The Trustees Of Columbia University In The City Of New York - New York NY
International Classification:
A61K 31/365
C07D 493/22
A61K 51/00
C12N 5/02
US Classification:
514462, 549265, 424 165, 435375
Abstract:
The present invention relates to Ginkgolide derivatives, compositions and extracts comprising one or more Ginkgolides and/or derivatives thereof and methods of use of the compositions to treat neurological disorders and as imaging agents.

Methods For Treating Mild Cognitive Impairment

View page
US Patent:
20090298864, Dec 3, 2009
Filed:
Apr 7, 2006
Appl. No.:
11/918295
Inventors:
Ottavio V. Vitolo - New York NY, US
Ottavio Arancio - New York NY, US
Michael L. Shelanski - Brooklyn NY, US
Assignee:
The Trustees of Columbia University in the City of New York - New York NY
International Classification:
A61K 31/435
A61K 31/4353
A61K 31/4015
A61P 25/28
US Classification:
514297, 514319, 514424
Abstract:
The present invention relates to compounds, compositions, and methods useful for: (i) treating or preventing mild cognitive impairment, or (ii) delaying the progression from mild cognitive impairment to Alzheimer's disease in a subject in need thereof.

Antisense Compounds Which Prevent Cell Death And Uses Thereof

View page
US Patent:
59290420, Jul 27, 1999
Filed:
Mar 3, 1997
Appl. No.:
8/810540
Inventors:
Carol M. Troy - Hastings-on-Hudson NY
Michael L. Shelanski - Brooklyn NY
Assignee:
The Trustees of Columbia University in the City of New York - New York NY
International Classification:
A01N 4304
US Classification:
514 44
Abstract:
The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.

Pluripotent Stem Cells Derived From Non-Cryoprotected Frozen Tissue And Methods For Making And Using The Same

View page
US Patent:
20160130561, May 12, 2016
Filed:
Jun 13, 2014
Appl. No.:
14/897225
Inventors:
- New York NY, US
Lauren Ab Vensand - New York NY, US
Carmen Dusenberry - Bronx NY, US
Scott Noggle - Long Island City NY, US
Michael Shelanski - Brooklyn NY, US
International Classification:
C12N 5/074
G01N 33/50
Abstract:
In some embodiments the present invention provides cells, such as pluripotent stem cells and differentiated cells, derived from tissue samples that have been frozen without a cryoprotective agent, and also cell panels comprising such cells, model systems comprising such cells, and methods for making and using such cells, cell panels, and model systems.
Control profile
Michael L Shelanski from Brooklyn, NY, age ~83 Get Report